RegulonDB RegulonDB 10.10: Gene Sequence
citG gene sequence


Size: 879        A: 199  T: 199  G: 239  C: 242

Fasta

 

>citG E. coli K12. Version NC_000913.3 GI:556503834
atgtcgatgcctgcaacgtcaactaaaaccacaaagcttgcgacgtcattaatcgatgag
tacgccctgctgggctggcgcgccatgctgactgaagtcaatctgtcaccgaaaccaggc
ctcgtggatcgcattaactgcggtgcgcacaaagatatggcgctggaagatttccaccgc
agcgcgctggcgattcagggctggctaccccgtttcattgaatttggtgcctgtagtgcg
gaaatggcaccagaagcggtactccacggattacgcccaattggtatggcttgcgaaggt
gatatgttccgcgccactgcgggcgtaaacacgcataaaggcagcattttttctttaggg
ctgctatgtgcggcaattggccgtttgcttcaactcaaccaaccggtaacgccaacaacc
gtttgttctacggcggcaagtttctgccgtggcctgaccgatcgcgaactgcgtaccaat
aattcacaactgacggcaggtcaacggttgtaccaacagcttggccttaccggcgcacgc
ggtgaagccgaagcgggttatccactggtgatcaatcacgccttgccgcattacctcact
ctgctggatcaggggttagatcctgaactggcattgctcgataccttgctcctactgatg
gcgatcaacggcgataccaacgttgcatcgcgcggtggcgaggggggcctgcgctggcta
cagcgcgaggcgcaaacattattgcaaaaagggggcattcgaacccccgccgatctcgat
tatctccggcagttcgacagggagtgtatcgaacgaaatctcagtccaggcggcagtgct
gacctactgatccttacctggtttttagcacagatttaa
              
                            

Download fasta file
RegulonDB