RegulonDB RegulonDB 10.10: Gene Sequence
citC gene sequence


Size: 1059        A: 264  T: 256  G: 250  C: 289

Fasta

 

>citC E. coli K12. Version NC_000913.3 GI:556503834
atgttcggcaatgatattttcacccgcgtaaaacgttcagaaaataaaaaaatggcggaa
atcgcccaattcctgcatgaaaatgatttgagcgttgacaccacagtcgaagtatttatt
accgtaacccgcgatgaaaagcttatcgcgtgcggtggaattgccggaaatattattaaa
tgcgttgctatcagtgaatccgtccgcggtgaaggactggcgctgacattagccactgaa
ttgataaacctcgcctatgagcggcacagcacgcatctgtttatttataccaaaaccgaa
tacgaggcgctgttccgccagtgcggtttttccacgctgaccagcgtacccggcgtgatg
gtgctgatggaaaacagcgccacgcgactgaaacgctatgccgaatcgctgaaaaaattt
cgtcatccagggaacaagattggctgcattgtgatgaacgccaatccctttacgaatggt
caccgttatctgattcaacaggctgcggcacagtgcgactggttgcatctgtttttagtc
aaagaagattcttcacgcttcccctatgaagaccggctggatttggtgttaaaaggcacc
gccgatattccacgcctgactgtgcatcgtggctccgaatacatcatctcccgcgctacg
ttcccttgctacttcattaaagaacagagcgtcattaaccattgttacaccgaaattgat
ctgaagattttccgtcagtacctcgctcccgcgctgggtgtaactcaccgctttgtcggt
actgaacccttttgtcgcgttaccgcccagtacaaccaggatatgcgctactggctggaa
acgccgactatctccgcaccgcccatcgaactggttgaaattgagcggctgcgttaccag
gagatgccgatatccgcttcccgggtacgtcaactgctggcgaaaaacgatctcacggct
atcgcgccgctggtccctgcagtcacgctgcattatttgcagaacctgcttgagcactcc
cgccaggacgcggcagctcgtcaaaagacccccgcatga
              
                            

Download fasta file
RegulonDB