RegulonDB RegulonDB 10.9: Gene Sequence
dpiB gene sequence


Size: 1659        A: 402  T: 426  G: 465  C: 366

Fasta

 

>dpiB E. coli K12. Version NC_000913.3 GI:556503834
atgttgcagcttaacgagaataaacagtttgcatttttccaaagactggcatttccgctg
cgtatctttttgctgattctggtgttctcaatatttgtcattgcagccctggcgcaatat
tttacggccagttttgaggactatttaacgcttcatgtacgcgacatggcaatgaatcag
gcgaaaattattgcctccaatgacagtgtcatctctgcggtgaaaacgcgtgactacaaa
cggctggcgaccatcgctaacaaattacaaagagataccgattttgattatgtggtgatt
ggggaccggcactcgatccgcctttaccatcctaatccggagaaaattggttatcctatg
cagttcaccaaacagggcgcgctggagaaaggggagagctacttcattaccgggaaaggg
tcaatggggatggcgatgcgcgccaaaacgccaatctttgatgacgatggaaaagtcatc
ggcgtggtgtcgattggctacctggtgagtaaaatcgatagctggcgggctgagttttta
ttaccgatggcaggtgtgtttgtcgtgctgttagggattctgatgttgctgtcgtggttc
ctggccgcgcatatccgtcggcagatgatgggcatggagccaaagcaaatcgcacgcgtg
gtccgtcagcaagaggcgctgtttagttcggtttatgaagggctgattgcggtggatccg
catggttacattaccgccatcaatcgtaacgcaagaaagatgctggggctgagttccccc
ggacggcaatggttgggtaaacccattgttgaagtggtcaggcccgccgatttctttacc
gaacagattgatgaaaaacgtcaggatgtggtggcgaactttaacggtctgagcgttatt
gccaaccgggaagctattcgttcaggtgatgatttgctgggggccattatcagctttcgt
agtaaagacgaaatttccaccctcaatgcgcaactgacgcaaataaaacaatacgttgag
agccttcgtacattgcgacacgagcatctcaattggatgtcgacgctcaatggtctgttg
cagatgaaagagtatgatcgcgtgctggcgatggtgcagggggagtctcaggcccagcaa
cagcttattgacagcctgcgcgaggcgtttgccgatcgccaggtggcggggctgcttttt
ggtaaagtgcagcgcgcccgggaactggggctaaaaatgatcattgtccccggtagccag
ctttcgcaactgccgccaggactggatagcaccgagtttgcagccattgtgggcaattta
cttgataacgccttcgaagccagcctgcgtagcgatgaaggaaacaagatcgttgaatta
ttcctcagcgatgaaggcgatgatgtggtgattgaagtcgccgatcagggctgcggcgtt
ccagagtctctacgagacaaaatatttgagcagggggtcagtacgcgtgctgacgagccc
ggtgaacatggcattgggttgtacttgattgccagctacgtaacgcgctgcggtggtgtt
atcactctcgaagataatgatccctgcggtaccttattttcaatctatattccgaaagtg
aaacctaatgacagctccattaaccctattgatcgttga
              
                            

Download fasta file
RegulonDB