RegulonDB RegulonDB 10.9: Gene Sequence
dpiA gene sequence


Size: 681        A: 176  T: 161  G: 180  C: 164

Fasta

 

>dpiA E. coli K12. Version NC_000913.3 GI:556503834
atgacagctccattaaccctattgatcgttgaggacgaaacgccgctggcagagatgcat
gcggaatatattcgtcacattcccggattcagtcagatattactggcgggaaatctggcg
caggcccgaatgatgatcgagcgttttaagccggggctaatcttgctcgataactatctt
cctgacggtagagggattaatttactgcatgaactggtgcaggcgcattatcccggcgac
gtggtgtttaccactgcagccagcgatatggaaacggtgtctgaagccgtacgttgtggt
gtatttgattatctcattaagcccattgcctatgaacggctggggcaaacgctaacccgt
ttccgccagcgtaaacatatgctggaaagtattgatagcgccagccagaagcaaattgat
gagatgtttaatgcttatgctcgcggtgaacctaaggacgagctaccgaccggcattgac
cccttgacgctaaacgcggtgcgaaaactgtttaaagagcctggtgtgcaacatacggca
gaaacggtggcgcaggcactgaccatcagccgcaccactgccaggcgttatcttgaatat
tgcgccagccgccatctgattattgctgaaattgttcacggcaaagttggcagaccacaa
cgcatataccacagtgggtga
              
                            

Download fasta file
RegulonDB