RegulonDB RegulonDB 10.9: Gene Sequence
dcuC gene sequence


Size: 1386        A: 268  T: 412  G: 369  C: 337

Fasta

 

>dcuC E. coli K12. Version NC_000913.3 GI:556503834
atgctgacattcattgagctccttattggggttgtggttattgtgggtgtagctcgctac
atcattaaagggtattccgccactggtgtgttatttgtcggtggcctgttattgctgatt
atcagtgccattatggggcacaaagtgttaccgtccagccaggcttcaacaggctacagc
gccacggatatcgttgaatacgttaaaatattactaatgagccgcggcggcgacctcggc
atgatgattatgatgctgtgtggatttgccgcttacatgacccatatcggcgcgaatgat
atggtggtcaagctggcgtcaaaaccattgcagtatattaactccccttacctgctgatg
attgccgcctattttgtcgcctgtctgatgtctctggccgtctcttccgcaaccggtctg
ggtgttttgctgatggcaaccctatttccggtgatggtaaacgttggtatcagtcgtggc
gcagctgctgccatttgtgcctccccggcggcgattattctcgcaccgacttcaggggat
gtggtgctggcggcgcaagcttccgaaatgtcgctgattgacttcgccttcaaaacgacg
ctgcctatctcaattgctgcaattatcggcatggcgatcgcccacttcttctggcaacgt
tatctggataaaaaagagcacatctctcatgaaatgttagatgtcagtgaaatcaccacc
actgctcctgcgttttatgccattttgccgttcacgccgatcatcggtgtactgattttt
gacggtaaatggggtccgcaattacacatcatcactattctggtgatttgtatgctgatt
gcctccattctggagttcctccgcagctttaatacccagaaagttttctctggtctggaa
gtggcttatcgcgggatggcagatgcgtttgctaacgtggtgatgctgctggttgccgct
ggggtattcgctcaggggcttagcaccatcggctttattcaaagtctgatttctatcgct
acctcgtttggttcggcgagtatcatcctgatgctggtattggtgattctgacaatgctg
gcggcagtcacgaccggttcaggcaatgcgccgttttatgcgtttgttgagatgatcccg
aaactggcgcactcttccggcattaacccggcgtatttgactatcccgatgctgcaggcg
tcaaaccttggccgtaccctttcgcccgtttctggcgtagtcgttgcggttgccgggatg
gcgaagatctcgccgtttgaagtcgtaaaacgcacctcggtaccggtgcttgttggtttg
gtgattgttatcgttgctacagagctgatggtgccaggaacggcagcagcggtcacaggc
aagtaa
              
                            

Download fasta file
RegulonDB