RegulonDB RegulonDB 10.9: Gene Sequence
cobC gene sequence


Size: 612        A: 148  T: 151  G: 160  C: 153

Fasta

 

>cobC E. coli K12. Version NC_000913.3 GI:556503834
atgcgactgtggttaattcgtcatggtgaaacgcaagcgaatatcgatggtctttacagc
ggtcatgcgcccacccccctgaccgcgcgcggtattgagcaagcgcaaaatctgcatacg
ctgctacatggtgtttcctttgatctggttttatgcagtgaactggaacgggcacagcat
accgcgcgactggttctcagtgaccgccagctccccgtgcaaatcatacctgaactcaac
gaaatgttttttggcgactgggagatgcgacatcatcgcgacctcatgcaagaagatgcc
gaaaactatagcgcgtggtgcaatgactggcagcatgcaatccccacgaacggtgaagga
tttcaggcattttcgcaacgtgtggaacgctttatcgcaaggcttagtgaatttcagcac
tatcagaatattttagtcgtcagccatcagggtgtactgagtctgttaatcgcccgttta
attggcatgcctgccgaagctatgtggcattttcgcgttgaccaggggtgttggagcgcc
attgatatcaaccaaaaattcgcgacgctacgcgtcctcaatagccgtgccatcggggtc
gagaatgcatga
              
                            

Download fasta file
RegulonDB