RegulonDB RegulonDB 10.9: Gene Sequence
ybeQ gene sequence


Size: 978        A: 287  T: 231  G: 254  C: 206

Fasta

 

>ybeQ E. coli K12. Version NC_000913.3 GI:556503834
atgattttcacgtcaagttgctgcgataatttatcaatagatgagattatcgaacgtgct
gaaaaaggcgattgcgaggctcaatatattgttgggttttattataatcgcgatagcgca
attgattctccggacgacgaaaaagccttttactggctgaagctggccgctgagcaaggt
cattgtgaagcacagtattccttagggcaaaagtataccgaggataaaagccgtcataaa
gataatgagcaagccatcttctggctgaaaaaagctgccctacaaggccatactttcgct
tccaacgcccttggctggacactggatcgtggagaagcccccaattataaagaagcggtt
gtctggtatcagatagccgcggagagcggaatgtcttatgcgcaaaataatcttgggtgg
atgtacagaaatggcaacggagtcgcaaaagactatgcgctggcatttttctggtacaaa
caagctgcattacaaggccatagtgacgcgcaaaacaatctggccgatctttatgaagac
ggaaaaggcgttgctcaaaacaagacactcgccgcattctggtatttgaaaagcgcacag
cagggtaatcggcacgcccagtttcaaattgcatgggattataacgctggcgaaggggtg
gaccaggactataagcaagcgatgtactggtatctgaaggctgccgctcaggggagcgtc
ggcgcttacgtcaacatcggttatatgtataaacacggacaaggcgttgagaaagattat
caggctgcctttgaatggtttacgaaagccgctgaatgcaatgacgccactgcctggtat
aacctggccattatgtatcactacggagaaggaagacctgtcgatctccgacaggctctc
gacctgtatcgtaaagttcagtcatccggaaccagagatgtcagtcaggaaattcgtgag
actgaagatttactgtag
              
                            

Download fasta file
RegulonDB