RegulonDB RegulonDB 10.9: Gene Sequence
ybeR gene sequence


Size: 708        A: 175  T: 209  G: 169  C: 155

Fasta

 

>ybeR E. coli K12. Version NC_000913.3 GI:556503834
atggacatggagtcgcaaaaaatattgtttgcactttccactccgatggaaatacgcaat
gaatgctgtttaccttcgcattcatcacccaaaatgtatttaggtacatgcttttttgac
ctttcttcctcatggggaattgatgaccgtgatgacctgctgcgcacaattcaccgaatg
atcgataacggtcatgccgctcggttggcagggttttatcaccgctggtttcgttattcg
ccatgtgaatggcgtgactatcttgctgaactaaatgagcaaggtcaggcttatgcgcaa
tttgtcgccagcaccgccgaatgctgtggcgaagggggaatcaaagcctgggattatgtc
cggatgggttttttaagccgaatgggcgtacttaataactggttgagcgaagaagaaagt
ctatggatccagtcgcgcattcatctacgggctctacgttattatagtaactggcggcaa
tactttgccggttatacctttggtcggcaatattggcagtctcccgaagatgatcatctg
cctttattacgcgaattcttagcgcgtaaagaatacgacgattccggcaatgatatgttt
tatcaattatttgccagtgatgatgcgtattaccctaccttgtcctggcaaccattggct
tactattctgcatgcccggaaacgcttaaggatatgagcgacctatga
              
                            

Download fasta file
RegulonDB