RegulonDB RegulonDB 10.9: Gene Sequence
djlB gene sequence


Size: 1428        A: 368  T: 382  G: 349  C: 329

Fasta

 

>djlB E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaattgctggaagatcctcgatatagaggaaacgactgacgtcgatattatccgc
cgcgcttatctggcgctgttaccgtcctttcatccagaaaccgatccgcagggttttaaa
caacttcgtcaggcgtatgaggaggcgctacggattgcgcagtcgcctgctaaatctgtt
tggcaaccagaagaatatgaggtagcagaacatgaaattctgctcgcctttcgtgcgtta
cttgcctctgatagtgaacgttttctgccctccgcctggcagcgattcattcagcaatta
aattattgctcgatggaggagattgatgaattacgctggtcgctgtgcacaatcgccatg
aacactgcccatttatccttcgagtgcgtggtgttattagcagaaagattgcggtggtta
caggaggaaaataccggggaaatagacgaagaagaactggaatcctttttatatgccatt
gcgaaggggaatgtttttaacttccagaccattctgcatctgcccgttgccgtgcaaaat
gacaccatcgatttttaccaaatgttcgctcggatttggtcatcgcatccacaatggctg
acattgtatttagcgcaacatcgcgcagtgattatccccgatgatgcaaaactgcacaga
aatttactccgctggtatagcgcaggtcgcctggatatccccgaacttctggattacgcc
cagtcatggcgggaaactgaacctgataatgaagatgcgccttattatgaatacgcgcaa
cgcgtctattgtggagaaggcgaaagcctgttggcagaactttgtgactactggcgcgag
tatccctccacccaggcggatgctttaatgttgcaatggtgccgtcagcatcgggtcgat
tattacccattactggtgatgatgattgaagcgcgtgatctggttaacgatcagggaaaa
ccgctactttatgtccccggcgacagcgcccgtacgcgttttcatttatacgaaatactc
agcgatgaaaaactctctgcgctggggcgttcactggtcgagatggttttgcacaaagga
cgtaagccgcggatctcactcacgcgtgatacagaacataccttatggccattatatcta
gttgccaaacaattagtgcaggcctgccaacctacagaagaatcattaatgccgattgtg
agccgccttgatgcagaaaatcgttgtccactggaagcattaattattcgtcgattatta
attcaggcggcgaattttaccgagaagcaaactgttgaaccggagccgcaaccgcagcca
atgcccgttgacgatggtgggccaggctgtctgggcatcattaaaattattttctatatt
tttatctttgctggtttgatagggaaaatactccatctgttcgggtga
              
                            

Download fasta file
RegulonDB