RegulonDB RegulonDB 10.9: Gene Sequence
ybeT gene sequence


Size: 555        A: 178  T: 140  G: 117  C: 120

Fasta

 

>ybeT E. coli K12. Version NC_000913.3 GI:556503834
atgaataaaaaattaatgtatatattcgcaatttttatagttgcagcaattacctgtatt
agccaacccaagaaaacgacgttgcgtgataaagccatggtgaattatgcctttgattat
ttaagctcaccgggcagtcttccattcaccacggcagccacggagctttccgcgattcat
ggtcactcaacgtcgcaatatcgccttggagaattttatcttcatggtagcgacggtaaa
ccactggattatacacaggcgagatactggtatgagcaatcagcggaacaggaaaatcca
cgcgcgcaaagtaaactggggtggatctacctcaaaggtctgggggtcaaacccgacacc
cgtaaagcaattctctggtataaggaagcagctgaacaagggtatgctcatgctcaatat
actttaggtttgatctacagaaatggctcaggtattaatgttaaccattatgaatctcaa
aaatggttaaaactgaccgccaaacaacattacaaaaatgcggaaagattacttgccggg
cttcccgcacattaa
              
                            

Download fasta file
RegulonDB