RegulonDB RegulonDB 10.9: Gene Sequence
ybeU gene sequence


Size: 708        A: 182  T: 189  G: 181  C: 156

Fasta

 

>ybeU E. coli K12. Version NC_000913.3 GI:556503834
atgaataaggaagaacaatatcttctttttgcgctttctgcgcccatggaaatacttaat
cagggttgcaaacccgcgcatgactcgccaaaaatgtatactgggataaaagaattcgag
ctctcatcatcctggggaataaataatcgtgatgatttaattcagactatttatcagatg
actgatgatggtcatgccaatgatttagctggcttatatctgacatggcatcgctcttcc
cctgaagagtggaaagcattaattgctggtggctcggagagagggttgatttatacccaa
ttcgttgcccaaaccgctatgtgctgtggggaagggggaatcaaagcctgggattatgtt
cgaatggggtttctgtcacgggtcggtgtgctcaacaagtggctgacggaagaagagagt
ttatggctgcaatcgcgcgtctatgtacgagctcaccattactatcacagctggatgcac
tatttttccgcctattcgttaggacgtctctactggcaatcttctcagtgcgaagacaac
acttcgctacgcgaggcgctaaccctgtacaaatacgatagcgccgggagtcgtatgttc
gaagagctggcagcgggaagcgatcgtttctatgccacgcttccctggcagccattaact
gtccagtctgaatgcccggtaacgcttaaggatgtgagcgacctatga
              
                            

Download fasta file
RegulonDB