RegulonDB RegulonDB 10.9: Gene Sequence
djlC gene sequence


Size: 1452        A: 390  T: 369  G: 392  C: 301

Fasta

 

>djlC E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacatgttggcaaatcctcgaaattgaaagcacgacgcaaatagacattatccgc
caggcttatcttgctcgcttaccgttgtgtcatcccgaaaccgatccgcaagggtttaaa
gcattacgccaggcctatgaagaggccctgcgactggcggtaaatcctgtcgaggaagca
gatgatgaagaaaaagatgctgccgctgaacatgaaatactacgtgcattcaggacatta
ctggattcagaaagtgatcgttttcagccttccgcctggcagaaatttattcagcaatta
aatacctggaacatggaggatgtcgatcaattacgctggccgctgtgtgcaatcgccata
gaagcgcgatatctttcattaaattgtgcttctttgctggcagagcgtttgaactggcat
tcatttaatgacagcgaaggaatggatgaggaagaaagggaggcttttcttgaggccatt
caggctggtgattgtttcgatttccttagccttctggaatatcccattgcgttgcagaac
cagactgttgagtattacttcgcgctggaacgttgctgccgttaccatcctgactatgtc
actgcgtttttggcgatggaaggtccgtggttaattcctgatgatgcaaagttacatcgc
aaactgttgcgctggtacagctcggtgcaaacaggtatggcggaactcattcctgtcgct
caacagtggcaaacggaagaaccagaaagcgaagatgcccggtattacttgtgtgcacaa
cgtttgtactgcggcgagggggaaagcctgcttgccgatctctgcgcgtactgggaaagt
tacccatctacacaagctgataatttgttgttgcagtggagcaagcgtcattgcccggat
tatttcgcgttattagtgatggttatcgaagcgcggagcatggtagatgcgcaaggtcaa
ccgctgaaatatgttcctggtgagagcgcccggacgcggctgttatgggcggagatttta
catagcggaaaattatcgccgttaggtcaatcgtttattgagtcgttattcttcaagcgc
aaagcatgggcgtggtggaaatcgagagtcggtagcgagacagagcaagattcaccgttc
ctggatttgtatcgggtagcggaacaggtagtacttgaagcgtttccgaaacaagagatg
ctggcccgtcttaatacaaggctggaaggcggagatgctcatccattagaggccattgtc
acccggatgcttttgacgaaagtgaaactcgagccggaggatgaagatgtcgatgagcca
acacctgaaaatcatgaagaaaaaaatgatgagggtgaaaaaccacagagcattaccagc
attatcaaaatcagtttaacggtgctggtgataggttatgctctcggcaaaatcgcgatg
ttgtttagctga
              
                            

Download fasta file
RegulonDB