RegulonDB RegulonDB 10.9: Gene Sequence
hscC gene sequence


Size: 1671        A: 429  T: 406  G: 450  C: 386

Fasta

 

>hscC E. coli K12. Version NC_000913.3 GI:556503834
atggataatgcagaactcgccattggtatcgatctcggtactaccaatagtttaattgcc
gtctggaaagacggtgccgcgcaattaattccaaataagttcggtgaatatttaacacca
tccataattagcatggatgaaaataatcatattttagtcggaaaaccggctgtatcacgg
cgtacttcgcatccggataaaacggcagcgttatttaaacgtgcaatgggcagtaatacc
aactggcggttaggcagcgacacatttaacgcgccagaactgtcctctttggtattacgc
tcattaaaagaagatgccgaagaatttctgcaacgtccgattaaagatgtggtgatctcc
gttccggcttatttcagcgatgaacaacgcaagcatacccgtttagcagcggagttagcc
gggttaaatgcggtacgcttaattaatgaacccacagcagctgcgatggcgtatggcctg
catacccaacaaaatacccgttcgctggtgtttgatctcggtggcggcacgtttgacgtt
acggtgcttgagtacgccacgccggtgattgaagttcacgcctccgctggcgacaacttt
cttggtggcgaagattttacccatatgctggtcgatgaggttttaaaacgcgcggatgtc
gccaggaccacgcttaacgagagtgaactggcagccttgtacgcctgtgtggaagcggca
aaatgtagcaatcaatcgccattgcacattcgctggcagtatcaggaagaaacgcgggaa
tgcgaattttacgagaacgaactggaagatttgtggttgccgctgctcaatcgcttgcga
gtgccgattgaacaggcgttgcgcgatgcgcgtctgaagccgagtcaaatcgacagtctg
gtgctggttggcggcgcgtcacaaatgccgctggtgcagcgaatcgccgtgcgtctgttt
ggcaaattaccgtatcaaagttacgatccgagcaccattgtcgcgctgggcgcagcaatc
caggccgcctgccgcttacgcagtgaagatattgaagaggtaatcctcactgatatttgc
ccttactcgttgggcgttgaagttaaccgccagggcgtttccggcattttctcgccgatt
attgaacgaaacaccactgtgcccgtgtcgcgtgtagaaacttattcaaccatgcacccg
gaacaggattcaattacggttaacgtctatcagggagaaaaccacaaagttaaaaacaac
attctggtggaatccttcgatgtgccgttgaagaaaaccggggcttatcagtcgattgat
attcgctttagttatgatatcaacgggttgcttgaagttgacgtgcttctggaagacggc
agcgttaagtccagagtgattaaccacagcccggtaacattgagcgcgcagcagattgaa
gagagtcggacgcggttatccgcattgaaaatttatccgcgcgatatgctcatcaatcgc
acctttaaagccaaactggaagagttgtgggcgcgggcgctgggtgacgagcgagaagag
atcggccgggtgatcaccgattttgatgcggcgttgcagtcaaacgatatggcccgcgtg
gatgaagttcggcggcgggcgagcgattatttagccattgagatcccataa
              
                            

Download fasta file
RegulonDB