RegulonDB RegulonDB 10.9: Gene Sequence
gltI gene sequence


Size: 909        A: 271  T: 195  G: 215  C: 228

Fasta

 

>gltI E. coli K12. Version NC_000913.3 GI:556503834
atgcaattacgtaaacctgccacagcaatcctcgccctggcgctttccgcaggactggca
caggcagatgacgccgccccggcagcgggcagtactctggacaaaatcgccaaaaacggt
gtgattgtcgtcggtcaccgtgaatcttcagtgcctttctcttattacgacaatcagcaa
aaagtggtgggttactcgcaggattactccaacgccattgttgaagcagtgaaaaagaaa
ctcaacaaaccggacttgcaggtaaaactgattccgattacctcacaaaaccgtattcca
ctgctgcaaaacggcactttcgattttgaatgtggttctaccaccaacaacgtcgaacgc
caaaaacaggcggctttctctgacactattttcgtggtcggtacgcgcctgttgaccaaa
aagggtggcgatatcaaagattttgccaacctgaaagacaaagccgtagtcgtcacttcc
ggcactacctctgaagttttgctcaacaaactgaatgaagagcaaaaaatgaatatgcgc
atcatcagcgccaaagatcacggtgactctttccgcaccctggaaagcggtcgtgccgtt
gcctttatgatggatgacgctctgctggccggtgaacgtgcgaaagcgaagaaaccagac
aactgggaaatcgtcggcaagccgcagtctcaggaggcctacggttgtatgttgcgtaaa
gatgatccgcagttcaaaaagctgatggatgacaccatcgctcaggtgcagacctccggt
gaagcggaaaaatggtttgataagtggttcaaaaatccaattccgccgaaaaacctgaac
atgaatttcgaactgtcagacgaaatgaaagcactgttcaaagaaccgaatgacaaggca
ctgaactaa
              
                            

Download fasta file
RegulonDB