RegulonDB RegulonDB 10.9: Gene Sequence
ybeX gene sequence


Size: 879        A: 226  T: 200  G: 236  C: 217

Fasta

 

>ybeX E. coli K12. Version NC_000913.3 GI:556503834
atgagcgacgacaattcacacagtagtgacacgataagcaacaagaagggatttttctcc
ctgttactcagccaacttttccacggtgaaccgaaaaaccgtgacgaactgctggcgctg
atccgtgattccgggcagaacgaccttatcgacgaagatacgcgcgatatgctcgaaggg
gtgatggacatcgcagaccaacgcgttcgcgacatcatgatcccccgctcccagatgatt
accctgaaacgcaaccagacgctggacgaatgtcttgatgtcatcatcgagtccgcccac
tcacgtttcccggtgattagcgaagacaaagatcacattgaagggattctgatggcgaaa
gacttgctgccgtttatgcgcagcgatgctgaagccttcagcatggacaaagtgttacgt
caggcggttgtcgttcctgaaagtaagcgcgtagaccggatgctgaaagagtttcgctct
cagcgttaccacatggcgatcgttattgacgaattcggtggggtttccggtctggtgacc
attgaagacatcctggaactgattgttggtgagattgaagacgagtatgacgaagaagat
gatatcgacttccgtcagctgagtcgtcatacctggaccgtacgcgcactggcttccatt
gaagacttcaacgaagcgttcggcacccactttagcgatgaagaagtcgacactatcggt
ggtctggtgatgcaggcatttgggcatcttccggcgcgtggcgaaactatcgacatcgac
ggttaccagttcaaagtggcgatggccgacagtcggcgtattattcaggttcatgtcaaa
atcccggatgactcaccccagccgaagctggatgaataa
              
                            

Download fasta file
RegulonDB