RegulonDB RegulonDB 10.9: Gene Sequence
ybeY gene sequence


Size: 468        A: 124  T: 102  G: 139  C: 103

Fasta

 

>ybeY E. coli K12. Version NC_000913.3 GI:556503834
atgagtcaggtgatcctcgatttacaactggcatgtgaagataattccgggttaccggaa
gagagccagtttcagacatggctgaatgcggtgatcccgcagtttcaggaagaatcggaa
gtgacgattcgcgtggtcgataccgccgaaagccacagtctgaatctgacctatcgcggt
aaggataagccgaccaacgtgctctccttcccgtttgaagtgccgcctggcatggaaatg
tcgctactgggcgatctggttatctgccgtcaggtggttgagaaggaagctcaggagcaa
ggcaaaccactggaggcgcactgggcgcatatggtggtgcacggcagtctgcatttgtta
ggttacgatcacatcgaagatgacgaagcagaagaaatggaagccctcgaaacagagatt
atgcttgctctgggctatgaggatccgtacattgccgagaaagaataa
              
                            

Download fasta file
RegulonDB