RegulonDB RegulonDB 10.9: Gene Sequence
ybeZ gene sequence


Size: 1041        A: 271  T: 204  G: 284  C: 282

Fasta

 

>ybeZ E. coli K12. Version NC_000913.3 GI:556503834
ttgaacatagacactcgcgaaatcaccctggagccagcagacaatgcgcgtctgttgagc
ctgtgcggcccgtttgatgacaacatcaagcagctcgaacgccgtctcggcatcgagatc
aatcgccgcgataaccactttaaactgaccggccgtccgatttgcgtcaccgctgcggca
gacattctgcgtagcctgtatgtcgatactgccccgatgcgcggtcagattcaggatatc
gaaccggaacagatccaccttgcgattaaagaagcgcgggtactggagcaaagcgcggag
agcgtgccggagtacggcaaagcggtcaatatcaaaaccaaacgcggcgtaattaagccg
cgcacgccaaaccaggcgcagtacatcgccaatattctcgaccatgacattaccttcggc
gttggcccggcgggtacgggtaaaacctacctggcagtggctgcggcagttgatgccctg
gagcgtcaggaaattcgccgtattctgctgactcgtccggcagtagaagccggtgagaaa
ctgggcttcctgcctggcgatttaagccagaaagtagacccgtatctgcgcccgctgtac
gacgcgctgtttgaaatgctgggctttgagaaagtcgagaaactgattgagcgcaacgtt
attgaagtcgcaccgctggcctatatgcgtggtcgtacgctgaacgacgcgtttatcatt
ctcgatgagagccagaacaccaccatcgaacagatgaagatgttcctgacccgtatcggt
tttaactcaaaagcggttatcaccggcgacgtcacacagatcgacctgccgcgtaatact
aaatcaggcttacgtcacgccatcgaagtgctggccgatgtcgaagagatcagctttaac
ttcttccacagcgaagacgtggttcgtcaccctgtggtggcgcgtatcgttaacgcctat
gaagcctgggaagaagccgaacaaaaacgaaaagcggcgctggcagcagaacgcaagcgc
gaagaacaggaacaaaaatga
              
                            

Download fasta file
RegulonDB