RegulonDB RegulonDB 10.9: Gene Sequence
miaB gene sequence


Size: 1425        A: 345  T: 308  G: 398  C: 374

Fasta

 

>miaB E. coli K12. Version NC_000913.3 GI:556503834
atgaccaaaaaactccatattaaaacctggggctgtcagatgaacgagtacgattcatcg
aagatggccgatctgctggatgccacccacggctatcaactgaccgacgtggcggaagaa
gcggatgtgctgctgctgaacacctgctcaatccgcgagaaggctcaggaaaaagtcttc
catcagttgggtcgctggaaactgttaaaagagaagaatccagacctgattatcggcgtc
ggtggctgcgtggcatcgcaagaaggcgagcacattcgccagcgcgcccactatgtcgat
attatttttgggccgcaaacgctgcaccgtctgccggagatgatcaactccgtgcgtggc
gaccgcagcccggttgtagatatcagcttcccggaaatcgagaagtttgaccgtctaccg
gaaccgcgcgccgaagggccgaccgcgtttgtctccatcatggaaggctgcaataaatat
tgcacctactgcgtggtgccttacacccgtggtgaagaggtaagccgtccgtccgacgat
attctgtttgagattgcccagcttgcggctcagggcgtgcgtgaagtcaacctgctcggt
cagaacgtgaacgcctggcgtggtgaaaactacgacggcaccaccggatcgtttgccgat
ctgctgcgtctggttgctgcgatcgacgggatcgatcgtattcgctttaccaccagccat
ccgatcgaattcaccgacgatatcatcgaagtgtatcgcgacacgccggagctggtgagc
ttcctgcatctgccggtacagagcggttccgatcgcattctgaacctgatgggccgtacc
catacggcgctggagtacaaagcgatcatccgtaaactgcgtgcggcgcgtccagatatt
cagatcagttctgatttcatcgttggcttccctggcgaaaccaccgaagacttcgagaaa
acgatgaagctgattgccgacgtcaatttcgacatgagctacagctttatcttctctgca
cgtccgggtacaccagccgccgatatggttgatgatgttccggaagaagagaagaagcag
cgtctgtatattctgcaagagcgcattaatcagcaagcgatggcgtggagccgccggatg
ctcggcaccacccagcgtattctggtagaaggtacatcgcgtaagagcatcatggagctt
tccgggcgtacggaaaataaccgcgtggtcaacttcgaaggcacgccggatatgatcggt
aaattcgtcgatgtagaaattaccgacgtctacccgaactctctgcgcggtaaagtggtg
cgtactgaagatgaaatgggtctgcgcgtggcagaaacaccggaatcagtgattgcccgt
acccgcaaagaaaacgaccttggcgtgggttattatcagccgtaa
              
                            

Download fasta file
RegulonDB