RegulonDB RegulonDB 10.8: Gene Sequence
chiP gene sequence


Size: 1407        A: 360  T: 326  G: 365  C: 356

Fasta

 

>chiP E. coli K12. Version NC_000913.3 GI:556503834
atgcgtacgtttagtggcaaacgtagtacgctggcgctggctatcgccggtgttacagca
atgtcgggctttatggcaatgccggaggctcgcgccgaaggattcatcgacgattcaacc
ttaaccggcggtatctattactggcagcgtgaacgcgaccgtaaagatgttaccgacggc
gacaaatacaaaaccaacctttctcactccacctggaatgccaacctcgattttcagtcc
ggttatgctgctgatatgttcggccttgatattgctgcgtttacggcgattgaaatggcg
gaaaacggcgacagctcccacccgaacgaaatcgcgttttcaaaaagtaataaagcctat
gacgaagactggtccggcgacaaaagcggtataagcctgtataaagctgcggccaaattt
aaatacggtccggtttgggcgagggcaggttacattcagccaactggtcaaacgctgtta
gcgccgcactggagctttatgccaggtacttatcagggggcggaagccggggcgaatttt
gattacggcgatgctggtgcgttgagtttctcctacatgtggaccaacgaatacaaagcg
ccgtggcatctggaaatggatgagttttatcagaacgataaaaccaccaaagttgattat
ctgcactcctttggggcgaaatacgacttcaaaaataacttcgtactggaagcggcattt
ggtcaggcggaagggtatatcgatcaatattttgccaaagccagctacaaatttgatatc
gccggtagcccgttaaccaccagctaccagttctacggtacccgagataaagttgacgat
cgcagcgtcaacgacctttatgacggcaccgcctggctgcaagcgttgacctttggttac
cgggcggctgacgtagtggatttgcgcctcgaaggcacctgggttaaggctgacggtcag
cagggatacttcctgcaacgtatgactccaacctacgcttcctcaaacggtcgcctggat
atctggtgggataaccgttctgacttcaacgccaacggcgaaaaagcggtcttcttcggt
gcgatgtatgacctgaaaaactggaatcttccaggcttcgccatcggcgcttcctacgtt
tacgcatgggatgctaaacctgcgacctggcagagcaatccggatgcgtactacgacaaa
aaccggactattgaagagtctgcctacagcctggatgcggtctataccattcaggacggt
cgcgccaaaggcacgatgttcaaactgcatttcaccgaatacgacaaccactccgacatc
ccaagctggggcggtggttacggcaacatcttccaggatgagcgtgacgtgaaatttatg
gtaatcgcaccattcaccatcttctga
              
                            

Download fasta file
RegulonDB