RegulonDB RegulonDB 10.9: Gene Sequence
ybfP gene sequence


Size: 495        A: 147  T: 123  G: 116  C: 109

Fasta

 

>ybfP E. coli K12. Version NC_000913.3 GI:556503834
atgaagaccaacaggagtctggtcgtcatagtgtcactaattaccgccacattactgctg
actgcatgcgcccaacctgaacaatcatcattagctggcgactggttactgacccctaaa
gataaaaccagaggattaacgggtagcattgcggtaaatattgcacctttccggtgtaag
acaaattgccgtggtgataacttacctgataatacccgccgctggcagttgtcaggcggg
aacgaaaaagaacttacttatcttcataatatgtcagcacaagaaaaggtcggtttaaat
cccggttggcaatgctacacctcattttttatgcgggtttgccagggcaagcccggcact
cgaccgatagtcaatgaggattatgtcagcgaaagcggattttttggctcgatgatgcat
gtcgggattattgagttacgacgctgccagtcagaaaattgccagcaagaattgaaagcg
ataaatacacattaa
              
                            

Download fasta file
RegulonDB