RegulonDB RegulonDB 10.9: Gene Sequence
ybfL gene sequence


Size: 1062        A: 344  T: 272  G: 254  C: 192

Fasta

 

>ybfL E. coli K12. Version NC_000913.3 GI:556503834
ttgtcaggcatcctactattgactatttttgccgttatttctggtgcagaaagttgggaa
gatatagaggatttcggggaaacacatctcgatttcttgaagcaatatggtgattttgaa
aatggtattcctgttcacgatactattgccagagttgtatcctgtatcagtcctgcaaaa
tttcacgagtgctttattaactggatgcgtgattgccattcatcaaatgataaagacgtc
attgcaattgatggaaaaacgctccggcactcttatgacaagagtcgccgcaggggagcg
attcatgtcattagtgcgttctcaacaatgcacagtctggtcatcgggcagatcaagacg
gataagaaatccaatgagatcacagctatccctgaacttcttaacatgctggatattaaa
ggaaaaatcatcacaactgatgcgatgggttgccagaaagatattgcagagaagatacaa
aaacagggaggtgattatttattcgctgtaaaaggaaaccaggggcggcttaataaagcc
tttgaggaaaaatttccgctgaaagaattaaataatccagagcatgacagttacgcaatg
agtgaaaagagtcacggcagagaagaaatccgtcttcatattgtttgcgatgtccctgat
gaacttattgatttcacgtttgaatggaaaggactgaagaaattatgcgtggcagtctcc
tttcggtcaataatagcagaacaaaagaaagagccagaaatgacggtcagatattatatc
agttctgctgatttaaccgcagaaaagttcgccacagcaatccgaaaccactggcacgtg
gagaataagctgcactggcgtctggacgtggtaatgaatgaagacgactgcaaaataaga
agaggaaacgccgcagaattattttcagggatacggcacatcgctattaatattttaacg
aatgataaggtattcaaggcagggttaagacgtaagatgcgaaaagcagccatggataga
aactatctcgcgtcagtccttgcggggagcgggctttcgtaa
              
                            

Download fasta file
RegulonDB