RegulonDB RegulonDB 10.8: Gene Sequence
ybgI gene sequence


Size: 744        A: 169  T: 177  G: 230  C: 168

Fasta

 

>ybgI E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaacaccgaactggaacaactgattaacgaaaaactgaacagcgcggcgattagt
gattacgcgccgaatggtttgcaggtggaaggcaaagagacggtgcaaaaaattgttacc
ggtgtcaccgccagccaggctttgctcgatgaggcagtgcgtctgggcgcggatgcggtc
attgtgcatcatggctacttctggaaaggagagtctccggtcattcgcggaatgaagcgt
aaccgtttaaaaacgttgctggcgaatgatatcaacctgtatggctggcatttgccgctt
gacgcacatcctgagctgggcaataacgcacagctggcggcgttactggggatcacggtc
atgggcgaaattgagccgttggtgccgtggggcgaactgaccatgcctgtgccgggactg
gagctggcttcctggattgaagcgcgtctgggacgtaagccgttatggtgtggcgatacc
ggacctgaggtggtccagcgcgtcgcctggtgcacgggcggcgggcaaagttttatcgat
agcgccgcgcgttttggcgtggatgcttttattactggcgaagtttctgaacagaccatt
cattcagcccgcgagcagggattgcatttttatgctgcaggtcaccatgccactgaacgt
ggtggtattcgcgcattgagcgagtggctgaatgaaaataccgatcttgatgtgaccttt
attgatattcctaatcctgcataa
              
                            

Download fasta file
RegulonDB