RegulonDB RegulonDB 10.9: Gene Sequence
abrB gene sequence


Size: 1047        A: 168  T: 291  G: 295  C: 293

Fasta

 

>abrB E. coli K12. Version NC_000913.3 GI:556503834
atgccagttttgcagtggggaatgttatgtgtgctatcacttctcctttctattggtttc
ctcgcggtacatctcccggcggcgctattacttgggccgatgatcgccgggatcatcttt
agtatgcgcggaattactctgcaacttccccgctctgcttttctcgccgcccaggccatt
cttggctgcatgattgcgcaaaacctcactggttcgattctcaccaccctggccgtcaac
tggccgatcgtgcttgcaattttactggtaacgctgctttccagcgccattgtgggttgg
ttattggtgcgctatagctcattgcctggaaataccggtgcctggggctcctctcctggc
ggcgcggcggcaatggtcgctatggcgcaagattacggcgcagatattcgcctggtggcg
tttatgcaatatctgcgagtgctgttcgtcgcgggggccgctgttctggtcacccgcatg
atgctgggcgataacgctgaagcggttaaccagcatatcgtctggttcccgccagtgagc
attaatctcctgcttactattttgctcgcggtcgttgccggtacagtgggatgcctgctg
cgtcttccttccggcacgatgctcatcccgatgctggcgggcgcagtgctccagtctggt
cagctcatcaccatcgaactaccggaatggctgctggcgatggcgtatatggcaattggc
tggcggattggtcttggtttcgataaacaaatcttactgcgggcactacgcccgctaccg
caaatcctgctgtcgatttttgctctgctggctatttgtgcgggtatggcgtgggggctg
acccggtttatgcacattgattttatgactgcctacctcgccaccagccccggcgggctt
gataccgtggcggtcatcgccgcagggagcaatgccgatatggcgctcattatggcgatg
caaaccctacgcctgttcagtattttgctgacagggcctgccattgcgcggtttatttca
acctatgcgccgaagcggtcggcctag
              
                            

Download fasta file
RegulonDB