RegulonDB RegulonDB 10.9: Gene Sequence
ybgP gene sequence


Size: 729        A: 214  T: 167  G: 169  C: 179

Fasta

 

>ybgP E. coli K12. Version NC_000913.3 GI:556503834
atgacatttattaaaggattacccttaatgttgttaaccatcagcttgggttgcaatgct
gcggtgcaacccgatcgcacacgcattgtgtttaacgccaatgacaaagccaccagcctg
cgtatcgaaaaccaaagtgacaaactgccttatcttgcttattcctggatagaaaatgaa
aaaggggagaaaagcgatgctcttctggtcgctttgccccctattcaacgtctggaaccg
aaagcgacatcgcaggtgcgggttgtgaaacaagcctcaaccacacaattacctggcgat
cgcgaaacgctatttttctacaatatgcgcgaaattcctcccgctccggataaaagcagc
gaccatgcgatacttcaggtcgctattcaaagtcgtattaaattgttctggcgaccggct
gcattacgcaagaaagcaggagaaaaggtcgaactgcagttacaggtcagccagcagggc
aaccaactgacactgaaaaatcctaccgcgtattatctgaccattgcctatctggggaga
aatgaaaaaggcgttctcccaggcttcaaaaccgtgatggttgcaccttttagtacggtc
aacacaaacaccggaagttatagcggcagccagttttatctcggttacatggatgattac
ggcgcattacgcatgacgacgctcaactgcagcggacaatgccgtttacaagcagtggag
gcgaaatga
              
                            

Download fasta file
RegulonDB