RegulonDB RegulonDB 10.9: Gene Sequence
ybgQ gene sequence


Size: 2448        A: 635  T: 590  G: 594  C: 629

Fasta

 

>ybgQ E. coli K12. Version NC_000913.3 GI:556503834
gtgaatatttatcgactctcttttgtatcctgcctggtcatggcgatgccttgcgcaatg
gcggtcgaattcaatctgaatgttctcgataaatcaatgcgcgaccgcattgatatttca
ttattaaaggaaaaaggagtcattgctcccggtgaatattttgttagcgttgcggtgaat
aacaacaaaatcagtaatgggcaaaaaattaactggcaaaaaaagggtgacaaaaccatt
ccatgcatcaatgattcactggtcgataaatttggtttaaaaccagatatccgtcagtcc
ttgccacagatagatcggtgtattgatttcagttcccgacctgaaatgctcttcaatttc
gatcaagccaatcagcaactgaatattagtattccgcaagcctggctggcgtggcactca
gaaaactgggctcccccctctacatggaaagaaggtgttgccggtgtcctgatggattac
aacttgtttgccagcagctaccgcccacaggacggcagcagcagcactaacctgaatgcc
tacggtaccgccggaattaacgccggggcatggcgcttacgcagtgattaccagcttaat
aagaccgatagcgaagataaccatgaccagtcaggcggaatatcgcgcacctatcttttt
cgtccattaccgcaattaggctctaagttaaccctcggcgaaaccgatttcagttccaat
attttcgatggtttttcttataccggcgcggcactggcgagtgacgatcgaatgttaccg
tgggagctgcgtggctacgccccacaaattagcggtattgcacagaccaatgccacggtg
acgatcagtcaatcaggccgcgtcatttaccagaaaaaagtcccgccaggcccgtttatt
attgatgacctcaatcagtctgttcagggcacgctggatgtcaaagtgacggaagaagat
ggtcgggtgaacaatttccaggtttcggcagcatcgacgcccttcctgactcgccaggga
caggttcgctataaattggccgcgggtcagccacggccttccatgtcacatcaaactgaa
aatgaaaccttttttagcaatgaagtttcctgggggatgctctcaaacacctcgctgtac
ggcggcctgctgatttctgatgatgactaccattctgccgcaatgggtatcgggcaaaat
atgctgtggcttggcgcactgtcctttgatgtcacctgggccagtagccattttgatact
cagcaggacgagcggggcttaagctaccgttttaattacagcaaacaagtggatgccacc
aacagcacgatttcgctcgccgcttatcgcttctcagatcgtcattttcacagctacgcc
aactatctggatcacaaatacaacgacagcgatgcgcaggacgaaaaacagacgatcagc
ttatccgtgggccaaccgattaccccactaaacctcaatctttacgccaacctgctacat
caaacctggtggaatgcagacgcctccacgaccgccaacatcacagcaggttttaatgtt
gatattggtgactggagagatatctcgatttcgacgtcattcaatacgacccactacgaa
gataaagatcgcgacaaccagatttatctgtcgatttcgctccccttcggtaacggtggt
cgggttggctatgacatgcaaaacagtagccacagcaccatacaccgcatgtcgtggaac
gatacgctggatgaacgtaatagctggggcatgtctgccggactgcaatccgatcgtccg
gacaatggagcccaggtgagcggtaactatcagcacctgagttcagcgggtgagtgggat
atttctggtacctatgccgccagtgattacagttccgtcagcagcagctggagcggttct
ttcaccgcaacccaatatggtgcagcatttcatcgccgcagctccaccaatgaaccacgc
ctgatggtcagcaccgatggcgtggcagatattccggttcagggcaatctcgactacacc
aaccattttggcattgcggtggtgccgttgatttccagttaccagccttccaccgtggcg
gtgaacatgaatgacttacccgacggcgtaacagttgcagaaaacgtcatcaaggaaaca
tggattgaaggcgcgataggttacaaatcactggcttcccgttccggtaaagacgttaac
gtcatcatacgcaacgccagcggtcagttccctcccctcggtgcggatatccgccaggat
gacagcggcattagcgtgggtatggttggcgaggaaggacatgcctggttaagcggtgtc
gctgaaaatcaactgtttaccgtggtctggggtgagcaaagctgcattattcatctgcca
gaacgtctggaagacacgaccaaacgcctgattttaccttgtcattaa
              
                            

Download fasta file
RegulonDB