RegulonDB RegulonDB 10.9: Gene Sequence
b0725 gene sequence


Size: 261        A: 82  T: 51  G: 62  C: 66

Fasta

 

>b0725 E. coli K12. Version NC_000913.3 GI:556503834
gtgaacgccttatccggcctacaagtcattacccgtaggcctgataagcgcagcgcatca
ggcgtaacaaagaaatgcaggaaatctttaaaaactgcccctgacactaagacagttttt
aaaggttccttcgcgagccactacgtagacaagagctcgcaagtgaaccccggcacgcac
atcactgtgcgtggtagtatccacggcgaagtaagcataaaaaagatgcttaagggatca
cgatgcagaacagcgctttga
              
                            

Download fasta file
RegulonDB