RegulonDB RegulonDB 10.9: Gene Sequence
pgl gene sequence


Size: 996        A: 222  T: 225  G: 292  C: 257

Fasta

 

>pgl E. coli K12. Version NC_000913.3 GI:556503834
atgaagcaaacagtttatatcgccagccctgagagccagcaaattcacgtctggaatctg
aatcatgaaggcgcactgacgctgacacaggttgtcgatgtgccggggcaggtgcagccg
atggtggtcagcccggacaaacgttatctctatgttggtgttcgccctgagtttcgcgtc
ctggcgtatcgtatcgccccggacgatggcgcactgacctttgccgcagagtctgcgctg
ccgggtagtccgacgcatatttccaccgatcaccaggggcagtttgtctttgtaggttct
tacaatgcgggtaacgtgagcgtaacgcgtctggaagatggcctgccagtgggcgtcgtc
gatgtggtcgaggggctggacggttgccattccgccaatatctcaccggacaaccgtacg
ctgtgggttccggcattaaagcaggatcgcatttgcctgtttacggtcagcgatgatggt
catctcgtggcgcaggaccctgcggaagtgaccaccgttgaaggggccggcccgcgtcat
atggtattccatccaaacgaacaatatgcgtattgcgtcaatgagttaaacagctcagtg
gatgtctgggaactgaaagatccgcacggtaatatcgaatgtgtccagacgctggatatg
atgccggaaaacttctccgacacccgttgggcggctgatattcatatcaccccggatggt
cgccatttatacgcctgcgaccgtaccgccagcctgattaccgttttcagcgtttcggaa
gatggcagcgtgttgagtaaagaaggcttccagccaacggaaacccagccgcgcggcttc
aatgttgatcacagcggcaagtatctgattgccgccgggcaaaaatctcaccacatctcg
gtatacgaaattgttggcgagcaggggctactgcatgaaaaaggccgctatgcggtcggg
cagggaccaatgtgggtggtggttaacgcacactaa
              
                            

Download fasta file
RegulonDB