RegulonDB RegulonDB 10.9: Gene Sequence
ybhD gene sequence


Size: 954        A: 271  T: 256  G: 231  C: 196

Fasta

 

>ybhD E. coli K12. Version NC_000913.3 GI:556503834
atgaagcatgaattatcaagtatgaaggcatttgtcatactggcagagtccagttcgttt
aacaatgccgctaaattactcaatattacgcaacctgcattaacgcgaagaataaaaaag
atggaggaagatttacatgttcaactatttgagcgtacaactcgcaaggttacgttaaca
aaagcaggaaaaaggttgctcccggaggcgcgggaattaataaagaaattcgatgaaacg
ctttttaatattcgtgatatgaatgcttatcatcgtggtatggtgacgttagcgtgtatt
ccgaccgcagtattttattttttaccgctggcaatcggtaaatttaatgagctgtatccc
aatattaaagtgcggattctggaacaaggcacgaataattgcatggaatcggtgctgtgt
aacgaatcagactttggcataaacatgaacaacgtcacaaattcatccattgattttacc
ccactggtcaacgagccgttcgtgctggcctgtcggcgtgaccatccattggccaaaaag
cagcttgtagaatggcaggagttagtgggttacaaaatgattggcgtacgctcctccagc
ggcaaccgactgttgatagaacaacagctggccgacaagccctggaagctggactggttt
tacgaagtgcgtcatctttcgacgtcattaggactggtggaggcgggactggggatttcg
gcgcttcctggcctggcaatgcctcatgcgccctattcttcgattattggtatcccattg
gtggaacccgttatacgtcgaacattgggaataattcgccgtaaagatgccgtactttct
ccagcagcagaacgcttttttgccttgctgattaatttatggactgacgataaagacaat
ttgtggaccaatatcgtcgaacgccagagacacgcgttacaggagataggttaa
              
                            

Download fasta file
RegulonDB