RegulonDB RegulonDB 10.10: Gene Sequence
ybhH gene sequence


Size: 1053        A: 263  T: 276  G: 272  C: 242

Fasta

 

>ybhH E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaaataccctgcgtgatgatgcgaggtggaacctcgaggggcgcgttcctgtta
gcggaacatttacccgaagatcaaacgcagcgcgataaaatattgatggcaattatgggt
tccggtaacgatctggaaattgacggtattggcggcggtaatccactgaccagtaaagtc
gccattattagccgttccagcgatccgcgtgctgatgtcgattatctgtttgcgcaggta
atcgttcatgagcaacgtgtcgataccacgcctaactgcggcaatatgctgtctggtgtt
ggggcattcgccattgaaaatggtttgattgcagcgacttcgccagttactcgcgtacgt
atccgcaacgtcaatacgggtacgttcatcgaagctgatgtgcaaacgccaaatggtgtt
gtcgagtacgagggtagcgccagaattgacggcgtaccgggtactgccgcaccggttgcg
ctcactttcctgaatgccgctggaaccaaaaccggaaaagttttcccgactgataatcag
attgattattttgacgatgtcccggtgacctgtatcgatatggcgatgccagtcgtcatt
attccggctgaatatctgggaaaaacaggttatgaattaccggcggaactggatgccgac
aaagcattattagcccgcattgaatctatccgtctacaagcgggtaaagcaatgggctta
ggtgatgtcagtaatatggttatccctaaacctgtgcttatttctccagcgcagaaaggc
ggggcaattaatgtgcgttattttatgccgcattcttgccatcgcgcgctggcgataacc
ggtgctattgctatttccagtagttgtgcattggaaggcaccgtcacccgacaaatcgtc
ccttctgtaggatacggcaatatcaatattgaacaccccagtggtgcgctcgacgttcat
ttaagtaatgaaggtcaggatgccacgacgttacgcgcatctgttattcggacgaccaga
aaaatattttccggtgaagtttatcttccctga
              
                            

Download fasta file
RegulonDB