RegulonDB RegulonDB 10.10: Gene Sequence
ybhI gene sequence


Size: 1434        A: 306  T: 414  G: 385  C: 329

Fasta

 

>ybhI E. coli K12. Version NC_000913.3 GI:556503834
atgaataagaaatcgttatggaagctaattctgatattagcgatcccatgtattattggt
tttatgccagctccggcaggattaagcgaactggcgtgggtgctttttggtatttacctg
gcggccattgtggggctggttatcaagcctttcccggaacctgtcgtactgttaattgcc
gttgctgcctcaatggtggtggtcggtaacttatccgacggtgcgtttaaaaccaccgcc
gtattaagcggttactcttcaggtaccacctggctggtgttctcggcgtttaccttaagc
gccgcatttgtgaccaccggtttaggtaaacgtattgcctatctgctgattggtaaaatc
ggtaacaccacgctgggtctgggttacgttacggtattcctcgatctggtactggctccg
gcaacaccgtctaacaccgcgcgtgcgggcggcattgtgttaccgatcatcaacagcgtg
gcggtggctttggggtccgaaccggaaaaaagtccgcgtcgtgtcggacattacctgatg
atgtccatttacatggtcaccaaaaccaccagctatatgttctttaccgcaatggcgggg
aacattctggcgctgaaaatgatcaacgacattctgcacctgcaaattagctggggtgga
tgggcgctggcagccggattgccgggcatcattatgctgctggtcaccccgctggtgatt
tacaccatgtatccaccagaaattaagaaggtggataacaaaaccatcgctaaagcgggc
cttgccgaactaggaccgatgaaaatccgcgaaaaaatgctgctcggtgtctttgtgctg
gcgctgctgggctggattttcagtaagtctctgggggttgatgaatccaccgtggcaatc
gttgttatggcaaccatgctgctgctgggtatcgttacctgggaagacgtggttaaaaat
aaaggcggctggaataccttaatctggtacggcggtattatcggcttaagctccttatta
tcgaaagttaaattcttcgaatggttagctgaagtctttaaaaataacctggcatttgat
ggtcacggtaacgttgctttcttcgttattattttcctcagcattatcgtgcgttatttc
ttcgcttccggtagtgcctatatcgttgctatgttaccggtatttgccatgctggcgaac
gtctccggcgcaccgttaatgttaaccgcgctggcactgttgttctccaactcctatggc
ggcatggttactcactatggcggcgcggcaggtccggtcatctttggcgtgggttataac
gatattaaatcctggtggttggtcggtgcggtactgacgatattaaccttcctggtgcat
atcaccctcggcgtgtggtggtggaatatgctgatcggctggaacatgctgtaa
              
                            

Download fasta file
RegulonDB