RegulonDB RegulonDB 10.9: Gene Sequence
ybhL gene sequence


Size: 705        A: 146  T: 216  G: 181  C: 162

Fasta

 

>ybhL E. coli K12. Version NC_000913.3 GI:556503834
atggacagattcccacgttctgattcaatcgtacaaccccgggctggcttgcaaacttat
atggctcaagtctatggctggatgaccgttggcttgttgctgaccgcatttgttgcctgg
tatgcggctaattccgcggccgtgatggagctgttgttcactaaccgtgtctttttaatc
ggtctgatcatcgcgcaattagcattggttattgtgttatcagcgatgattcaaaagctg
agcgcaggtgtaacgacgatgctctttatgctttattcggcgctgacgggtcttacgctt
tccagtatattcattgtctataccgctgcttctatcgccagtactttcgtcgttactgcc
gggatgttcggcgcaatgagcctgtacggttacaccacgaagcgcgatttaagtggcttt
ggcaatatgctgtttatggcgttaatcggcattgtgctggcatcgctggtcaacttctgg
ttgaaaagcgaagcattgatgtgggcagttacctacatcggcgtgattgtctttgtcgga
ttgacggcgtatgacacgcagaaactgaaaaatatgggtgagcagattgatacccgcgac
acgtcgaacctgcgcaaatattccattcttggcgcgttaaccttgtatctggacttcatc
aacctgttcctgatgttgttgcggatcttcggcaaccgccgttaa
              
                            

Download fasta file
RegulonDB