RegulonDB RegulonDB 10.9: Gene Sequence
ybhM gene sequence


Size: 714        A: 179  T: 233  G: 170  C: 132

Fasta

 

>ybhM E. coli K12. Version NC_000913.3 GI:556503834
atggaatcatactcgcaaaacagcaataaattagattttcagcacgaggccaggatatta
aacggtatatggctcattaccgctttaggtttggtggcaaccgcaggactagcctgggga
gctaagtatatcgaaattacggcaaccaaatatgattcaccaccaatgtatgtcgccata
gggttattattactttgtatgtatggcttaagtaaggatatcaacaagataaatgccgcc
atcgcgggcgtaatatatctgtttttactctctttggtggcgattgtcgttgcaagttta
gttcctgtatatgccattatcatcgtgttcagcactgcgggcgcgatgtttttaatcagt
atgctggccggtttattatttaatgttgatcctggttctcaccgttttatcattatgatg
acgttgacagggttggccctggtaatcatcgtgaatgcggcattaatgagtgaacggccc
atttggataataagttgcttaatgattgtgttatggtcaggcattatctcgcatggacga
aataagctccttgaattggcggggaaatgccatagtgaagagttgtggagtccggttcgt
tgcgcttttacaggtgcattaacactctattactattttatcggcttctttgggatactt
gccgcgatagctataacgcttgtctggcaaaggcatacgcgtttttttcattag
              
                            

Download fasta file
RegulonDB