RegulonDB RegulonDB 11.1: Gene Sequence
ybhS gene sequence


Size: 1134        A: 216  T: 293  G: 324  C: 301

Fasta

 

>ybhS E. coli K12. Version NC_000913.3 GI:556503834
atgagtaacccgatcctgtcctggcgtcgcgtacgggcgctgtgcgttaaagagacgcgg
cagatcgttcgcgatccgagtagctggctgattgcggtagtgatcccgctgctactgctg
tttatttttggttacggcattaacctcgactccagcaagctgcgggtcgggattttactg
gaacagcgtagcgaagcggcgctggatttcacccacaccatgaccggttcgccctacatc
gacgccaccatcagcgataaccgtcaggaactgatcgccaaaatgcaggcggggaaaatt
cgcggtctggtggttattccggtggattttgcggaacagatggagcgcgccaacgccacc
gcaccgattcaggtgatcaccgacggcagtgagccgaataccgctaactttgtacagggg
tatgtcgaagggatctggcagatctggcaaatgcagcgagcggaggacaacgggcagact
tttgaaccgcttattgatgtacaaacccgctactggtttaacccggcggcgattagccag
cacttcattatccccggtgcggtgaccattatcatgacggtcatcggcgcgattctcacc
tcgctggtggtggcgcgagaatgggaacgcggcaccatggaggctctgctctctacggag
attacccgcacggaactgctgctgtgtaagctgatcccttattactttctcgggatgctg
gcgatgttgctgtgtatgctggtgtcagtgtttattctcggcgtgccgtatcgcgggtcg
ctgctgattctgttttttatctccagcctgtttttactcagtaccctggggatggggctg
ctgatttccacgattacccgcaaccagttcaatgccgctcaggtcgccctgaacgccgct
tttctgccgtcgattatgctttccggctttatttttcagatcgacagtatgcccgcggtg
atccgcgcggtgacgtacattattcccgctcgttatttcgtcagcaccctgcaaagcctg
ttcctcgccgggaatattccagtggtgctggtggtaaacgtgctgtttttgatcgcttcg
gcggtgatgtttatcggcctgacgtggctgaaaaccaaacgtcggctggattag
              
                            

Download fasta file
RegulonDB