RegulonDB RegulonDB 11.1: Gene Sequence
ybhG gene sequence


Size: 999        A: 226  T: 203  G: 316  C: 254

Fasta

 

>ybhG E. coli K12. Version NC_000913.3 GI:556503834
gtgatgaaaaaacctgtcgtgatcggattggcggtagtggtacttgccgccgtggttgcc
ggaggctactggtggtatcaaagccgccaggataacggcctgacgctgtatggcaacgtg
gatattcgtacggtaaatcttagtttccgtgttggggggcgcgttgaatcgctggcggtg
gacgaaggtgatgctatcaaagcgggccaggtgctgggcgaactggatcacaagccgtat
gagattgccctgatgcaggcgaaagcgggtgtttcggtggcacaggcgcagtatgacctg
atgcttgccgggtatcgcaatgaagaaatcgctcaggccgccgcagcggtgaaacaggcg
caagccgcctatgactatgcgcagaacttctataaccgccagcaagggttgtggaaaagc
cgcactatttcggcaaatgacctggaaaatgcccgctcctcgcgcgaccaggcgcaggca
acgctgaaatcagcacaggataaattgcgtcagtaccgttccggtaaccgtgaacaggac
atcgctcaggcgaaagccagcctcgaacaggcgcaggcgcaactggcgcaggcggagttg
aatttacaggactcaacgttgatagccccgtctgatggcacgctgttaacgcgcgcggtg
gagccaggcacggtcctcaatgaaggtggcacggtgtttaccgtttcactaacgcgtccg
gtgtgggtgcgcgcttatgttgatgaacgtaatcttgaccaggcccagccggggcgcaaa
gtgctgctttataccgatggtcgcccggacaagccgtatcacgggcagattggtttcgtt
tcgccgactgctgaatttaccccgaaaaccgtcgaaacgccggatctgcgtaccgacctc
gtctatcgcctgcgtattgtggtgaccgacgccgatgatgcgttacgccagggaatgcca
gtgacggtacaattcggtgacgaggcaggacatgaatga
              
                            

Download fasta file
RegulonDB