RegulonDB RegulonDB 10.9: Gene Sequence
ybiX gene sequence


Size: 678        A: 167  T: 152  G: 172  C: 187

Fasta

 

>ybiX E. coli K12. Version NC_000913.3 GI:556503834
atgatgtaccacattcccggcgtgttatcgccacaggacgtcgctcgttttcgcgaacaa
ctggaacaagccgaatgggtggatggacgcgtcaccaccggcgcacaaggtgcgcaagtt
aagaacaatcaacaggtcgacacccgcagcacgttatacgccgccctgcaaaatgaggtg
ctgaacgcggttaaccaacatgctttattctttgccgcggccttgccgcgtaccctttcc
acgccgctgtttaatcgctatcagaacaatgaaacctatggtttccatgtggatggcgca
gtacgcagccatccacaaaacggctggatgcgtactgacctttctgccacgctgttttta
agcgatccacaaagctacgacggcggcgaactggtcgttaatgacaccttcggacaacat
cgggtaaaactcccggcaggcgatctcgtgttgtatccctccagcagcctgcattgcgtg
acacccgtaacccgcggcgtacgagtggcatcatttatgtggatccagtcgatgatccgc
gatgataaaaagcgcgccatgctgtttgaactggacaacaatattcagtcgctgaaaagc
cgctacggcgaaagtgaagagatcctgtcgctgcttaatctttatcataatctgctgcgg
gaatggtcggagatctga
              
                            

Download fasta file
RegulonDB