RegulonDB RegulonDB 10.9: Gene Sequence
mcbA gene sequence


Size: 261        A: 75  T: 49  G: 66  C: 71

Fasta

 

>mcbA E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaagtgcctcacactactgattgccaccgtcctgagcggaatctctctcacggct
tatgccgcgcaaccgatgagtaacctggacagcggtcagctacggcccgccggtaccgtt
tcggcaactggcgcatcaaacctaagcgatctggaggataaactggcagaaaaagcgcgc
gaacaaggcgcgaaaggttatgtcattaattccgcaggcggaaatgaccagatgttcggt
actgcaaccatctacaaataa
              
                            

Download fasta file
RegulonDB