RegulonDB RegulonDB 10.9: Gene Sequence
ybiO gene sequence


Size: 2226        A: 471  T: 568  G: 603  C: 584

Fasta

 

>ybiO E. coli K12. Version NC_000913.3 GI:556503834
atgcggtggatcctgttcatcctcttctgcctgctgggcgcacctgcccacgcggtatcc
atacccggcgttacaaccacaacgacaacggactcaacgactgaaccggccccggaaccg
gatatcgaacaaaaaaaagcggcctatggcgcactggcggatgtgctggataatgacacc
tcgcgtaaagagttgatcgaccagttgcgcaccgttgccgctacgccccctgctgaaccg
gtaccaaaaatagtgccgccgacgctggtcgaagagcaaaccgtgctgcaaaaggtcacc
gaagtcagccgccattatggtgaagccctttccgcccgcttcgggcaactttatcgcaat
atcaccggctccccgcataagccgtttaatccacaaaccttcagcaatgcgctgacccat
ttttcaatgttagcggtattagtgtttggtttttactggctgattcgcctgtgcgcactg
ccgctgtatcgcaaaatgggtcagtgggcgcggcaaaaaaatcgtgagcgcagcaactgg
ttgcagcttccggcgatgattatcggggcgtttattatcgacctgctgttactggccctg
acattatttgtcggccaggtattaagcgacaacctgaatgcaggcagtcgcaccatcgct
ttccaacaaagtttgtttctcaacgcctttgccctcattgaatttttcaaagccgtacta
cgcctgattttttgcccaaacgtggcggagctgcgcccgttcacgattcaggacgagagc
gcccgttactggagtcgtcgcctgagctggttaagcagtttgataggttatggcctgatt
gtggccgtgccgattatctctaatcaggtgaatgtacagataggtgcgctggcgaacgtc
atcattatgctgtgcatgaccgtctgggcgttgtacctgatctttcgtaataaaaaagag
attacccagcatttgctcaacttcgcggagcattcgctggcctttttcagcctgtttatc
cgcgcctttgcgctggtgtggcactggctggcaagcgcctattttatcgtgctgtttttc
ttttcgttgttcgatccgggcaacagcctgaaatttatgatgggtgcaacggtgcgcagc
ctggcgattattggtatcgcagcgtttgtttccggtatgttttcccgctggctggcgaaa
accatcactctctcgccacatactcagcgtaactatccggagctgcaaaaacggttgaat
ggctggctgtcggcggcgctgaaaacggcgcgtattctgacagtctgcgtggcggtaatg
ttgctgttgagcgcatggggattgttcgatttctggaactggctgcaaaacggcgcgggg
cagaaaaccgtagatatcctgatccgtatcgcactcattcttttcttctcggcggttggc
tggacggtgctcgccagtttgatcgaaaaccggctggcttcggatattcatggccgcccg
ctacccagcgcccgcacgcgtaccctgcttacgctgtttcgtaacgcgctggcggtgatt
atcagtaccatcaccatcatgattgtgttgtcggaaatcggcgtcaatatcgcgccattg
ctggcaggtgccggggcattaggtctggctatctcgtttggttcgcaaacgctggtgaaa
gatattatcaccggggtatttattcagtttgaaaacggcatgaacactggagatttggtg
actatcgggccgttgaccggcacagtggaacggatgtcgattcgctccgtgggcgtacga
caggataccggggcgtatcacatcattccgtggtcttcgataaccacctttgctaacttt
gtccgcggcattggttcggtggtggcaaattatgatgttgatcgccatgaagatgctgat
aaagccaatcaggcactgaaagatgcggtagcggaattaatggaaaacgaagaaattcgc
gggctgattattggtgaaccgaattttgccgggattgtcggcttaagcaataccgcgttt
acactgcgtgtttcgttcaccacgctgccactcaaacagtggacggtacgctttgccctc
gacagccaggtgaaaaaacatttcgacctggcgggcgttcgcgcgccagtgcagacttat
caggtgctgcctgctccgggcgcgaccccggctgaaccgttaccgccgggggaaccaacg
ctttaa
              
                            

Download fasta file
RegulonDB