RegulonDB RegulonDB 10.9: Gene Sequence
opgE gene sequence


Size: 1584        A: 409  T: 409  G: 379  C: 387

Fasta

 

>opgE E. coli K12. Version NC_000913.3 GI:556503834
atgaatttaaccctcaaagaatcgcttgttacccgtagccgggtatttagcccgtggact
gcgttctactttttacagtcgctattaattaacctcggcttaggttaccccttcagtttg
ctctacaccgctgcgtttacggctattttgcttttgctatggcgaacattgcctcgcgta
caaaaagttctggtcggtgtcagttcgctggtggcggcttgttatttcccttttgctcag
gcctacggcgcgcctaatttcaatacattgctggcattgcactccaccaatatggaagag
tcgaccgaaatcctgacgatttttccgtggtacagctacctggtcggcttatttattttt
gcgctcggcgtaatagcaatcaggcgaaaaaaagagaatgaaaaagcgcgctggaatacc
ttcgacagcctgtgtctggtattcagtgtggcgacattttttgttgctcccgtgcaaaac
ctggcctggggtggcgtatttaaactgaaagatactggctatccggtatttcgttttgct
aaggatgtcatcgtcaataataacgaggtgattgaagagcaagaacggatggcaaaactt
tccggaatgaaagatacctggacggtcactgccgttaagccgaagtatcagacctatgtg
gtggtgatcggtgaaagcgcgcgtcgcgatgccctcggtgcctttggcggtcactgggac
aataccccgtttgccagcagcgttaacggtttgatatttgctgactacattgccgccagt
ggctccacgcagaaatcgcttggcttaacgctcaatcgcgttgtcgatggcaaaccacag
tttcaggataactttgtcaccctggcaaatcgcgcgggcttccagacctggtggttttcc
aaccagggtcaaatcggcgaatacgataccgctatcgccagcatcgccaaacgagcagat
gaagtgtacttcctgaaagaaggtaattttgaagcagataaaaacaccaaagacgaagcg
ttactggatatgaccgctcaagtgctggcgcaagagcactcgcaaccgcagctgattgtt
ctacatctgatgggctcacatccgcaggcctgcgacaggacacaaggaaaatacgaaacc
tttgtgcaatcgaaagaaacgtcgtgctatctctataccatgacgcaaacggacgattta
ctgcgcaagctgtacgatcagttacgcaacagcggcagcagcttctcgctggtttacttt
tctgaccacggtctggcctttaaagagcgcggtaaagacgtgcaataccttgcccatgat
gataaatatcagcaaaatttccaggtgccttttatggtcatttccagcgacgataaagcg
catcgtgtgattaaagcccgccgctcagccaatgacttcttaggctttttctcccagtgg
acggggattaaagcgaaggaaattaacatcaaatacccgtttatatctgagaagaaagcc
gggccgatatacatcaccaacttccagttacagaaggtggattacaaccatctcggaacc
gatattttcgacccgaaaccttaa
              
                            

Download fasta file
RegulonDB