RegulonDB RegulonDB 10.9: Gene Sequence
ybiR gene sequence


Size: 1119        A: 199  T: 335  G: 330  C: 255

Fasta

 

>ybiR E. coli K12. Version NC_000913.3 GI:556503834
atgagcctgccttttttacgcacgctgcaaggcgatcgtttttttcagttattaattctt
gttggtatcggattaagctttttcgtgccctttgcaccgaaatcctggcctgctgctatc
gactggcacaccatcatcaccttaagcggcctgatgctgctgaccaaaggtgtggagtta
agcggttattttgatgtgctggggcgcaaaatggtgcgccgctttgctacggagcgtcgg
ctggcgatgtttatggtgctggcggcggcgctgctttctacctttctgaccaacgatgtc
gcgctgtttattgttgttccgctgactatcacgctaaaaagactgtgtgagatcccggtt
aatcggctgattatttttgaggcgctggcagtcaacgctggttcgctactgacgccaatt
ggcaacccgcaaaatattcttatctggggacgttctggtctttcgtttgccggatttatt
gcccaaatggcaccgctggctggcgcaatgatgctgacgctcctgctcctgtgctggtgt
tgtttccctggaaaggcgatgcaataccatacgggggtgcaaacaccggagtggaaaccg
cggctggtgtggagttgtctggggctgtatatcgtctttctgacggcgctggagttcaaa
caagagctgtggggactggtgattgtggcggcaggctttgcgctgctggcacgtcgcgtg
gtgctcagtgtggactggacgctgctgctggtgtttatggcgatgtttatcgacgtccat
ttactgacccagcttccagcgttgcaaggcgtgttgggtaacgtgagtcatctatctgaa
cccgggttatggttaacggcaatcggtttatcgcaggtgatcagtaacgtgccgagtacc
atattgttgctgaactatgtgccgccgtctttattactggtatgggcggtaaacgtaggt
ggctttgggttattacccggatcgctggcaaatttgattgcgctacgtatggcgaacgat
cgccgcatctggtggcgtttccatctctattcaataccgatgctgttgtgggcggcgttg
gtgggatatgttttgttagttatactcccggccaactag
              
                            

Download fasta file
RegulonDB