RegulonDB RegulonDB 10.9: Gene Sequence
ldtB gene sequence


Size: 921        A: 223  T: 210  G: 245  C: 243

Fasta

 

>ldtB E. coli K12. Version NC_000913.3 GI:556503834
atgaatatgaaattgaaaacattattcgcagcggccttcgctgttgtcggcttttgcagt
accgcctctgcggtaacttatcctctgccaaccgacgggagtcgcctggttggtcagaat
caggtgatcaccattcctgaaggtaacactcagccgctggagtattttgccgccgagtac
cagatggggctttccaatatgatggaagcgaacccgggtgtggataccttcctgccgaaa
ggcggtactgtactgaacattccgcagcagctgatcctgccggataccgttcatgaaggc
atcgtcattaacagtgctgagatgcgtctttattactatccgaaagggaccaacaccgtt
atcgtgctgccgatcggcattggtcagttaggcaaagatacgcctatcaactggaccacc
aaagttgagcgtaaaaaagcaggcccgacctggacgccgaccgccaaaatgcacgcagag
taccgcgctgcgggcgaaccgcttccggctgtcgttccggcaggtccggataacccgatg
gggctgtatgcactctatatcggtcgcctgtatgctatccatggcaccaacgccaacttc
ggtatcggcctgcgtgtaagtcatggttgtgtgcgtctgcgtaacgaagacatcaaattc
ctgttcgagaaagtaccggtcggtacccgcgtacagtttattgatgagccggtaaaagcg
accaccgagccagacggcagccgttatattgaagtccataacccgctgtctaccaccgaa
gcccagtttgaaggtcaggaaattgtgccaattaccctgacgaagagcgtgcagacagtg
accggtcagccagatgttgaccaggttgttcttgatgaagcgattaaaaaccgctccggg
atgccggttcgtctgaattaa
              
                            

Download fasta file
RegulonDB