RegulonDB RegulonDB 10.8: Gene Sequence
ybiT gene sequence


Size: 1593        A: 399  T: 353  G: 459  C: 382

Fasta

 

>ybiT E. coli K12. Version NC_000913.3 GI:556503834
gtgttagtttccagtaacgtcaccatgcagttcggcagtaagccgttgtttgaaaacatt
tccgtcaaatttggcggcggcaaccgttacggcctgattggcgcgaacggtagtggtaaa
tccacctttatgaagatcctcggcggcgaccttgagccgacgctgggtaacgtttccctc
gatcccaacgagcgcattggtaaactgcgtcaggatcagtttgcctttgaagagttcact
gtgctggatacggtgatcatggggcataaagagttgtgggaagtgaagcaggagcgcgac
cgcatctatgctttgccggaaatgagtgaagaagacggctataaagtggccgatctggaa
gttaaatacggcgaaatggacggttactctgcggaagctcgcgccggtgaactgttgctt
ggcgtgggaattccagtggaacagcactacggcccgatgagtgaagttgctcctggctgg
aagctgcgtgtgcttctggcgcaggcgctgtttgctgatccggatattctcctgctcgac
gaaccgaccaacaacctcgacatcgacaccattcgctggctggaacaggtgctgaacgag
cgtgacagcaccatgatcatcatctcgcacgaccgtcacttccttaacatggtctgtacc
cacatggcggatctggattacggcgagctgcgcgtttatccgggtaactacgatgagtac
atgacggcggcgacccaggcgcgtgaacgtctgctggccgataacgccaagaagaaagcg
cagattgctgagttgcaatctttcgttagccgctttagcgccaacgcctcgaaatctcgc
caggcaacttcgcgcgcgcgccagattgataaaatcaaactggaagaggtgaaagcctcc
agccgtcagaacccgttcatccgttttgaacaggataagaaactgttccgtaacgcgctg
gaagtggaaggtctgaccaaagggtttgataacggtccgctgtttaaaaatctcaacctg
ctgctggaagtgggtgaaaaactggcggtactgggtaccaacggcgtcggtaaatcaacg
ctgctgaaaacgctggtgggcgatctgcaaccggacagcggcaccgtaaaatggtctgag
aacgcgcgcattggttactatgctcaggaccacgaatatgagtttgaaaatgatctgacc
gtgttcgaatggatgagccagtggaagcaggaaggcgatgacgagcaggcggtacgcagt
attctcggtcgtttgctgttcagccaggacgacatcaaaaagccagctaaagtgctttcc
ggtggggaaaaagggcggatgctgtttggtaagttaatgatgcagaagccgaacattctg
atcatggacgaaccgaccaaccacctggatatggaatccattgagtcgctgaacatggca
ctggaactgtatcagggcacgctgatctttgtttcacacgaccgtgagttcgtaagctcc
ctggcgacccgcattctggaaatcaccccggaacgcgtgatcgactttagcggtaattac
gaagattacctgcgtagtaaagggatcgagtaa
              
                            

Download fasta file
RegulonDB