RegulonDB RegulonDB 10.9: Gene Sequence
ybiV gene sequence


Size: 816        A: 229  T: 206  G: 195  C: 186

Fasta

 

>ybiV E. coli K12. Version NC_000913.3 GI:556503834
atgagcgtaaaagttatcgtcacagacatggacggtacttttcttaacgacgccaaaacg
tacaaccaaccacgttttatggcgcaatatcaggaactgaaaaagcgcggcattaagttc
gttgttgccagcggtaatcagtattaccagcttatttcattctttcctgagctaaaggat
gagatctcttttgtcgcggaaaacggcgcactggtttacgaacatggcaagcagttgttc
cacggcgaactgacccgacatgaatcgcggattgttattggcgagttgctaaaagataag
caactcaattttgtcgcctgcggtctgcaaagtgcatatgtcagcgaaaatgcccccgaa
gcatttgtcgcactgatggcaaaacactaccatcgcctgaaacctgtaaaagattatcag
gagattgacgacgtactgttcaagttttcgctcaacctgccggatgaacaaatcccgtta
gtgatcgacaaactgcacgtagcgctcgatggcattatgaaacccgttaccagtggtttt
ggctttatcgacctgattattcccggtctacataaagcaaacggtatttcgcggttactg
aaacgctgggatctgtcaccgcaaaatgtggtagcgattggcgacagcggtaacgatgcg
gagatgctgaaaatggcgcgttattcctttgcgatgggcaatgctgcggaaaacattaaa
caaatcgcccgttacgctaccgatgataataatcatgaaggcgcgctgaatgtgattcag
gcggtgctggataacacatccccttttaacagctga
              
                            

Download fasta file
RegulonDB