RegulonDB RegulonDB 10.8: Gene Sequence
fsaA gene sequence


Size: 663        A: 146  T: 158  G: 211  C: 148

Fasta

 

>fsaA E. coli K12. Version NC_000913.3 GI:556503834
atggaactgtatctggatacttcagacgttgttgcggtgaaggcgctgtcacgtattttt
ccgctggcgggtgtgaccactaacccaagcattatcgccgcgggtaaaaaaccgctggat
gttgtgcttccgcaacttcatgaagcgatgggcggtcaggggcgtctgtttgcccaggta
atggctaccactgccgaagggatggttaatgacgcgcttaagctgcgttctattattgcg
gatatcgtggtgaaagttccggtgaccgccgaggggctggcagctattaagatgttaaaa
gcggaagggattccgacgctgggaaccgcggtatatggcgcagcacaagggctgctgtcg
gcgctggcaggtgcggaatatgttgcgccttacgttaatcgtattgatgctcagggcggt
agcggcattcagactgtgaccgacttacaccagttattgaaaatgcatgcgccgcaggcg
aaagtgctggcagcgagtttcaaaaccccgcgtcaggcgctggactgcttactggcagga
tgtgaatcaattactctgccactggatgtggcacaacagatgattagctatccggcggtt
gatgccgctgtggcgaagtttgagcaggactggcagggagcgtttggcagaacgtcgatt
taa
              
                            

Download fasta file
RegulonDB