RegulonDB RegulonDB 10.8: Gene Sequence
gsiA gene sequence


Size: 1872        A: 401  T: 460  G: 544  C: 467

Fasta

 

>gsiA E. coli K12. Version NC_000913.3 GI:556503834
ttgccacacagtgatgaacttgatgccggtaatgtgctggcggttgaaaatctgaatatt
gcctttatgcaggaccagcagaaaatagctgcggtccgcaatctctcttttagtctgcaa
cgcggtgagacgctggcaattgttggcgaatccggctccggtaagtcagtgactgcgttg
gcattgatgcgcctgttggaacaggcgggcggtttagtacagtgcgataaaatgctgttg
cagcggcgcagtcgcgaagtgattgaacttagcgagcagaacgctgcacaaatgcgccat
gttcgcggtgcggatatggcgatgatatttcaggagccgatgacatcgctgaacccggta
tttactgtgggtgaacagattgccgaatcaattcgtctgcatcagaacgccagtcgtgaa
gaagcgatggtcgaggcgaagcggatgctggatcaggtacgcattcctgaggcacaaacc
attctttcacgttatccgcatcaactctctggcgggatgcgccagcgagtgatgattgcg
atggcgctgtcatgccgcccggcggtgctgattgccgatgagccaaccaccgcgctggat
gtcactattcaggcgcagatcctgcaattaatcaaagtattgcaaaaagagatgtcgatg
ggcgttatctttatcactcacgatatgggcgtggtggcagagattgccgatcgggtactg
gtgatgtatcagggcgaggcggtggaaacgggtaccgtcgaacagatttttcatgcaccg
caacatccttacacccgtgcgctgttagctgctgttccgcaacttggtgcgatgaaaggg
ttagattatccccgacgtttcccgttgatatcgcttgaacatccagcgaaacaggccccc
cccatcgagcagaaaacggtggtggatggcgaacctgttttacgagtgcgtaatcttgtc
acccgtttccctttgcgcagcggtttgttgaatcgcgtaacgcgggaagtgcatgccgtt
gagaaagtcagttttgatctctggcctggcgaaacgctatcgctggtgggcgagtctggc
agcggtaaatccactaccgggcgggcgttgctgcgcctggtcgaatcgcagggcggcgaa
attatctttaacggtcagcgaatcgataccttgtcacccggcaaacttcaggcattacgc
cgggatattcagtttatttttcaggacccttacgcttcgctggacccacgtcagaccatc
ggtgattcgattatcgaaccgctgcgtgtacacggtttattgccaggtaaagacgcggct
gcacgcgttgcgtggttgctggagcgcgtgggcctgttacctgaacatgcctggcgttac
ccgcatgagttttccggcggtcagcgccagcgcatctgcattgctcgcgcgttggcattg
aatccaaaagtgatcattgccgacgaagccgtttcggcgctggatgtttctattcgcggg
cagattatcaacttgttgctcgatctccagcgtgatttcggcattgcgtatctgtttatc
tcccacgatatggcggtggtagagcggattagtcatcgtgtggcggtgatgtatctcggg
caaattgttgaaattggtccacggcgcgcggtcttcgaaaacccgcagcatccttatacg
cgtaaattactggcggcagttccggtcgctgaaccgtcccgacaacgaccgcagcgtgta
ctgctgtcggacgatcttcccagcaatattcatctgcgtggcgaagaggtggcagccgtc
tcgttgcaatgcgtcgggccggggcattacgtcgcacaaccacaatcagaatacgcattc
atgcgtagataa
              
                            

Download fasta file
RegulonDB