RegulonDB RegulonDB 10.9: Gene Sequence
gsiB gene sequence


Size: 1539        A: 407  T: 328  G: 432  C: 372

Fasta

 

>gsiB E. coli K12. Version NC_000913.3 GI:556503834
atggcaagagctgtacaccgtagtgggttagtggcgctgggcattgcgacagcgttgatg
gcatcttgtgcattcgctgccaaagatgtggtggtggcggtaggatcgaatttcaccacg
ctcgatccgtatgacgcaaatgacacgttatctcaggccgtagcgaaatcgttttaccag
gggctgttcggtctggataaagagatgaaactgaaaaacgtgctggcggagagttatacc
gtttccgatgacggcattacttacaccgtgaaattgcgggaaggcattaaattccaggat
ggcaccgatttcaacgccgcggcggtgaaagcgaatctggaccgggccagcgatccggcg
aatcatcttaaacgctataacctgtataagaatattgctaaaacggaagcgatcgatccg
acaacggtaaagattaccctcaaacagccgttctcagcgtttattaatattcttgcccat
ccggcgaccgcgatgatttcaccggcagcgctggaaaaatatggcaaggagattggtttt
tatccggtgggaaccggaccgtatgaactggatacctggaatcagaccgattttgtgaag
gtgaaaaaattcgcgggttactggcagccaggattgcccaaactggacagcataacctgg
cgtccggtggcggataacaacacccgcgcggcaatgctgcaaaccggtgaagcgcagttt
gctttccccattccttacgagcaggccacactgctggagaaaaacaaaaatatcgagttg
atggccagtccgtcaattatgcagcgttatatcagtatgaacgtgacgcaaaagccgttc
gataacccgaaggtccgtgaggcgctgaattacgccattaaccgtccggcgctggtgaaa
gttgcctttgcgggctatgcaacgccagctactggtgtggtaccgccaagtatcgcctac
gcgcaaagttataaaccgtggccttacgatccagtgaaagcgcgcgaattactgaaagag
gcgggatatcccaacggtttcagtaccacgctgtggtcgtcacataaccacagcaccgcg
cagaaagtgctgcaatttacccagcagcagttagcgcaggtcgggattaaagcccaggtg
actgcgatggatgccggacagcgggcggcagaagttgaaggtaaagggcaaaaagagagc
ggcgtgcggatgttctacactggctggtcggcttcaaccggcgaagcggactgggcacta
tcgccgctgtttgcctcgcagaactggccaccgacgctgtttaataccgcgttttacagc
aataaacaggtggatgacttcctggctcaggcactgaaaactaatgatccggcggaaaag
acccgcttatataaggcggcgcaggatatcatctggcaagaatcgccgtggatcccgctg
gtggtagaaaaactggtgtcggcacacagtaaaaacctgaccggtttttggatcatgcca
gacaccggcttcagctttgaagacgcggatttgcaataa
              
                            

Download fasta file
RegulonDB