RegulonDB RegulonDB 11.0: Gene Sequence
gsiC gene sequence


Size: 921        A: 165  T: 263  G: 277  C: 216

Fasta

 

>gsiC E. coli K12. Version NC_000913.3 GI:556503834
atgcttaattacgttatcaaacgcttactggggttgattccgacgctgtttatcgtctcg
gtgctggtgtttttatttgtccatatgctgcccggcgatccggcgcgattgattgccggg
cccgaagctgatgcgcaggttatagaactggtgcgtcagcagctggggttggatcagccg
ctgtatcaccagttctggcactatatcagcaatgctgtgcagggggattttggcctgtcg
atggtgtcgcgtcgtccggttgccgatgagattgccagccgctttatgccaacgctgtgg
ctgaccataaccagtatggtctgggcggttatatttggtatggcggcgggaattatcgcc
gccgtctggcgtaaccgttggccggatcgattgagtatgaccattgcggtgtcggggatc
tcgtttccggcatttgctctggggatgcttttaattcaggtattctccgttgaactgggc
tggctgcctaccgtgggagcagacagttggcagcactacattttaccctccctgacgctc
ggcgcggcagtggccgccgtgatggcgcgctttacccgcgcgtcgtttgtcgatgtttta
agcgaagattatatgcgtaccgcgagggcgaaaggggtgagcgaaacctgggttgtcctc
aaacacgggctacgtaacgcgatgatcccggtagtgaccatgatgggcttacagtttggc
tttttgctcggtggttccatcgttgtggagaaagttttcaactggccgggacttggacgc
ttactcgttgactccgtagaaatgcgtgattacccggtgattcaggcggaaattctgctt
ttctcgctggaatttattcttatcaacttagtggtggatgtgctttacgccgccattaac
ccggctatcaggtacaagtaa
              
                            

Download fasta file
RegulonDB