RegulonDB RegulonDB 10.9: Gene Sequence
gsiD gene sequence


Size: 912        A: 157  T: 271  G: 260  C: 224

Fasta

 

>gsiD E. coli K12. Version NC_000913.3 GI:556503834
atgcgactatttaactggcgacgtcaggcggtgttaaacgccatgccactggtcaaacct
gaccaggtacgtacaccgtggcatgaattctggcgacgatttcgccgtcagcatatggcg
atgaccgccgcattattcgttattttattgattgtggtggccatttttgcacgctggatc
gctccctatgacgccgaaaattattttgattatgacaatctgaataacggaccttctttg
cagcactggtttggcgtcgattcactggggcgtgacattttcagccgtgtcctggttggt
gcgcaaatctcgctggcggcgggcgtgtttgccgtgtttatcggtgcggcgatcgggacg
ttgctgggcttgctcgctggatattatgaaggctggtgggatcggctgatcatgcgcatt
tgcgatgtgctgtttgccttcccgggtattttactggcgatcgctgttgttgcggtgttg
ggaagcggcattgctaacgtgattattgcagtcgccattttttccatccccgcgtttgcc
cgcctggtgcgcggcaacacgctggtgttgaaacagcaaacctttattgagtcagcacgc
agtattggtgccagcgatatgaccgttttgttgcgtcatatcctgcctgggaccgtctct
tctatcgtggtgtttttcaccatgcgcattggtacctcgattatctctgccgccagcctc
tcatttctcggcctcggtgcgcagccgccgacaccagagtggggagcaatgctcaatgag
gctcgagcggatatggttatcgcgccgcatgtcgctgtttttccggccctggctattttt
ctgaccgtactggcgttcaatttgttgggcgatggtttacgcgatgcgctggatccgaaa
attaaaggatag
              
                            

Download fasta file
RegulonDB