RegulonDB RegulonDB 10.9: Gene Sequence
pdeI gene sequence


Size: 2349        A: 687  T: 685  G: 540  C: 437

Fasta

 

>pdeI E. coli K12. Version NC_000913.3 GI:556503834
atgctgagtttatacgaaaagataaagataaggctgataattttatttttattggcagca
ctgtcatttattggtctttttttcatcattaactatcaactggtatcggagcgcgcggta
aaacgtgccgatagccgctttgaacttattcagaaaaacgttggctatttctttaaagat
attgaacgttcggccctgacattaaaggactcactgtatttattaaaaaatacagaggag
attcaacgcgccgtgattcttaaaatggaaatgatgccatttttagactcggtgggactg
gtacttgatgataataaatattatcttttttcgcggagggcgaatgataaaatcgttgtt
tatcatcaggaacaagtaaatggaccgcttgtcgacgagtcagggcgggttatttttgcc
gattttaacccatcgaaacgaccgtggtcggtggcttcagatgactctaacaacagctgg
aatccggcatacaattgctttgatcgtccgggtaaaaaatgtatctcttttacgctacac
atcaacggcaaagatcacgatttgttagcggtggataaaattcatgtcgatttaaactgg
cgatatctgaacgagtatcttgatcaaatcagcgctaatgatgaagttctatttttgaaa
caaggccatgagatcattgccaagaatcaactcgctcgtgaaaaactgattatttataat
agcgaaggtaattataatattattgattctgtcgatactgaatatatcgaaaaaacatca
gcggtgccaaacaacgcattattcgaaatctatttttattatcctggcggtaatttattg
aacgcatcagataaacttttttatctgccgtttgcgttcattattatcgtattgctggtg
gtttatttaatgaccactcgtgtgttccgtcggcaattttctgaaatgacagagctggtt
aatacgctggcgtttttgcctgactcaacggatcaaatcgaggctctgaaaattcgtgaa
ggcgatgcgaaagagattatcagcatcaaaaattcgatcgcggaaatgaaagatgccgaa
attgaacggtcaaataaattgctctcactgatctcttacgatcaggaaagtggttttatt
aaaaatatggcgattattgagtctaacaataatcagtatctggctgtggggatcatcaaa
ctgtgtggtctggaagccgtggaagcggtgtttggtgttgatgagcgcaataaaatcgtc
aggaaattgtgtcagcgaattgccgagaaatatgcgcaatgctgcgatatcgtgacattc
aatgccgatctctatttacttctgtgtcgggaaaatgtacagacatttacccgtaaaata
gcgatggtaaacgattttgacagcagctttggctaccgcaatctgcgcatccataagtct
gccatttgtgaacctttgcagggggaaaacgcctggagttacgcagaaaaactgaaactg
gcgatttccagtatccgtgaccatatgttctcagagtttattttctgtgatgacgcgaaa
ctcaacgaaatagaagagaatatctggattgcgcgtaatattcgccatgcaatggaaatt
ggcgaactattcctcgtctatcaaccgatcgttgatattaacacccgcgccattctgggc
gcggaggcgttgtgccgttgggtgtctgcggagcgggggatcatttcaccgctgaagttc
attaccattgctgaagatatcgggtttatcaatgagctgggttatcagattattaaaacg
gcaatgggtgaattcagacattttagtcagcgtgcgtcgctgaaggatgatttcttactg
catattaatgtttcgccctggcagttaaacgaaccacactttcatgagcgttttaccacc
atcatgaaagaaaatggcctgaaggcgaacagcctctgtgttgagatcactgaaaccgtg
atcgagcgaattaatgaacatttttatctcaatattgaacaactgcgtaaacaaggggta
cggatatcgattgatgactttggcaccggtttgtcaaacctgaaacgtttttatgaaatt
aatccagacagcataaaggtggactcgcaattcaccggcgatattttcggtactgcggga
aaaattgtgcgcattattttcgacctggcacgctataaccggatcccggtgattgcggaa
ggcgtagagagcgaagacgttgcgcgcgaattaatcaaattaggatgtgttcaggctcag
gggtatctgtaccagaaacccatgccattctccgcctgggataaaagtggaaaattagta
aaagagtag
              
                            

Download fasta file
RegulonDB