RegulonDB RegulonDB 10.9: Gene Sequence
ybjG gene sequence


Size: 597        A: 108  T: 181  G: 162  C: 146

Fasta

 

>ybjG E. coli K12. Version NC_000913.3 GI:556503834
atgctggaaaatttgaatctctctctattctctcttattaacgcgacgccagactcggct
ccgtggatgatctcgttggcgatttttattgctaaagatttgattaccgtggtgccgttg
ctggccgtggtactttggttgtgggggcttacagcacaacggcaactggtgataaaaatc
gctatcgcgctggcggtcagcctgtttgtgtcctggacgatgggacatctttttccgcac
gaccgaccctttgtcgaaaatatcggctataacttcctgcatcatgcggcggatgactca
ttcccaagcgatcacggtacggtgattttcacctttgcactggcatttttatgctggcat
cgcctgtggtccggctcacttttaatggtgctggccgtcgtcattgcctggtcgcgcgtt
tatcttggcgtccactggccgctggatatgctcggtggattgctggcaggtatgattggc
tgccttagtgcccagattatctggcaagcgatggggcataaactctatcaacgtctgcaa
tcgtggtatcgcgtctgttttgcattaccgatccgcaaaggctgggtgcgtgactga
              
                            

Download fasta file
RegulonDB