RegulonDB RegulonDB 10.9: Gene Sequence
mdfA gene sequence


Size: 1233        A: 236  T: 351  G: 368  C: 278

Fasta

 

>mdfA E. coli K12. Version NC_000913.3 GI:556503834
atgcaaaataaattagcttccggtgccaggcttggacgtcaggcgttacttttccctctc
tgtctggtgctttacgaattttcaacctatatcggcaacgatatgattcaacccggtatg
ttggccgtggtggaacaatatcaggcgggcattgattgggttcctacttcgatgaccgcg
tatctggcgggcgggatgtttttacaatggctgctggggccgctgtcggatcgtattggt
cgccgtccggtgatgctggcgggagtggtgtggtttatcgtcacctgtctggcaatattg
ctggcgcaaaacattgaacaattcaccctgttgcgcttcttgcagggcataagcctctgt
ttcattggcgctgtgggatacgccgcaattcaggaatccttcgaagaggcggtttgtatc
aagatcaccgcgctgatggcgaacgtggcgctgattgctccgctacttggtccgctggtg
ggcgcggcgtggatccatgtgctgccctgggaggggatgtttgttttgtttgccgcattg
gcagcgatctcctttttcggtctgcaacgagccatgcctgaaaccgccacgcgtataggc
gagaaactgtcactgaaagaactcggtcgtgactataagctggtgctgaagaacggccgc
tttgtggcgggggcgctggcgctgggattcgttagtctgccgttgctggcgtggatcgcc
cagtcgccgattatcatcattaccggcgagcagttgagcagctatgaatatggcttgctg
caagtgcctattttcggggcgttaattgcgggtaacttgctgttagcgcgtctgacctcg
cgccgcaccgtacgttcgctgattattatgggcggctggccgattatgattggtctattg
gtcgctgctgcggcaacggttatctcatcgcacgcgtatttatggatgactgccgggtta
agtatttatgctttcggtattggtctggcgaatgcgggactggtgcgattaaccctgttt
gccagcgatatgagtaaaggtacggtttctgccgcgatgggaatgctgcaaatgctgatc
tttaccgttggtattgaaatcagcaaacatgcctggctgaacgggggcaacggactgttt
aatctcttcaaccttgtcaacggaattttgtggctgtcgctgatggttatctttttaaaa
gataaacagatgggaaattctcacgaagggtaa
              
                            

Download fasta file
RegulonDB